unix - Remove line breaks in a FASTA file

Question

I have a fasta file where the sequences are broken up with newlines. I'd like to remove the newlines. Here's an example of my file:

>accession1
ATGGCCCATG
GGATCCTAGC
>accession2
GATATCCATG
AAACGGCTTA

I'd like to convert it into this:

>accession1
ATGGCCCATGGGATCCTAGC
>accession2
GATATCCATGAAACGGCTTA

I found a potential solution on this site, which looks like this:

cat input.fasta | awk '{if (substr($0,1,1)==">"){if (p){print "
";} print $0} else printf("%s",$0);p++;}END{print "
"}' > joinedlineoutput.fasta

However, this places an extra line break between each entry, so file looks like this:

>accession1
ATGGCCCATGGGATCCTAGC

>accession2
GATATCCATGAAACGGCTTA

I'm an awk noob, but I took a shot at modifying the command. My guess was the if (p){print " ";} was the culprit...potentially print " " is adding two line breaks. I couldn't figure out how to add just one newline...this is probably something easy, but like I said, I'm a noob. Here was my (unsuccessful) solution:

awk '{if (substr($0,1,1)==">"){print "
"$0} else printf("%s",$0);p++;}END{print "
"}' input.fasta > joinedoutput.fasta

However, this adds an empty line at the beginning of the file because it's always printing a new line before it prints the first accession number:

{empty line} 
>accession1
ATGGCCCATGGGATCCTAGC
>accession2
GATATCCATGAAACGGCTTA

Anyone have a solution to get my file in the correct format? Thanks!

Answer 1

This awk program:

% awk '!/^>/ { printf "%s", $0; n = "
" } 
/^>/ { print n $0; n = "" }
END { printf "%s", n }
' input.fasta

Will yield:

>accession1
ATGGCCCATGGGATCCTAGC
>accession2
GATATCCATGAAACGGCTTA

Explanation:

On lines that don't start with a >, print the line without a line break and store a newline character (in variable n) for later.

On lines that do start with a >, print the stored newline character (if any) and the line. Reset n, in case this is the last line.

End with a newline, if required.

Note:

By default, variables are initialized to the empty string. There is no need to explicitly "initialize" a variable in awk, which is what you would do in c and in most other traditional languages.

--6.1.3.1 Using Variables in a Program, The GNU Awk User's Guide